Завершено

java project - need a fully experienced java freelancer

need a java freelancer, who is an expert with java to solve three challenges, they are basic java coding challenges need to be done asap by a professional freelancer, should be done asap within 10-15 mins

here is challenges:

first:

* Within this Calculator class you will need to create 4 methods.

* The four methods will relate to the basic functions of a calculator and should be named:

* <p>

* - add

* - subtract

* - multiply

* - divide

* <p>

* Each method accept 'int' two numbers and return the int value.

* <p>

* Don't forget to look at the tests for guidance.

second:

* A string is simply an ordered collection of symbols selected from some alphabet and formed into a word; the length of a string is the number of symbols that it contains.

*

* An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG."

*

* Given: A DNA string s of length at most 1000 nt.

*

* Return: Four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.

*

* Sample Dataset

* AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

*

* Sample Output

* 20 12 17 21

*

*/

/**

* The Challenge

*

* You will need to implement the counters as per the name in names in the return statement.

* You will then need to create a loop to parse each Char within the string and count them

* by passing the values to counters.

third

Квалификация: Java, Javascript, JavaFX

Показать больше php project need freelancer programmer, freelancer java project, need java expert help, need java expert, freelancer java email project, freelancer java project pune, project need expert jquery datatables believe, java project need, need clicks ads freelancer project, freelancer java project in uae, what type of project need to make find job on freelancer, freelancer java project in pune, freelancer java spring mvc project, freelancer java spring project, how to get freelancer java project, project freelancer java backend, project freelancer java backend kassel, project need freelancer, www freelancer com projects net ocr project need train segment, I need an experienced freelancer to fix some bugs on existing websites and an app

О работодателе:
( 5 отзыв(-а, -ов) ) london, United Kingdom

ID проекта: #20907151

Поручен:

ironstar20311

Hi ⭐ I can finish in 1hr, I am very confidence I have read your requirement very carefully. So I am really confidence your project. I have rich experiences with java GUI and Game and Machine Learning and string opera Больше

£50 GBP за 1 день
(17 отзывов(-а))
4.1

12 фрилансеров(-а) в среднем готовы выполнить эту работу за £133

iridescent2x15

HI I am software engineer and have done many java and technical projects. You can discuss more details with me so that we can negotiate the price accordingly. Thank you

£150 GBP за 7 дней(-я)
(52 отзывов(-а))
5.9
polarjin2017

Hello? Nice to meet you. I am excited to work with you on this project. I am ready to start work immediately. Here are my working result for php, mysql, api integration, ajax, jquery etc. [login to view URL] h Больше

£135 GBP за 7 дней(-я)
(56 отзывов(-а))
6.0
Itblast

I love building interactive experiences, especially restful single-page web applications. I am a full-stack Javascript/TypeScript developer and have shipped projects in most major front-end frameworks & libraries (An Больше

£150 GBP за 3 дней(-я)
(14 отзывов(-а))
5.2
dungforever

Hello mate I am very glad to place a bid to your project I have read your description carefully and i am so interested in your project. I am skillful java and javafx developer and i have finished a lot of project of th Больше

£100 GBP за 2 дней(-я)
(48 отзывов(-а))
5.2
CliveLewis

Hello! :) I checked the description of your project and can tell that these tasks are very simple and I can complete them right now. I work as a Java developer full-time, so trust me, this "project" will be done in no Больше

£30 GBP за 1 день
(1 отзыв)
2.4
chilakalapudi

Hi there, I can implement the given tasks with Java. please consider me to work on this Project. thanks.

£100 GBP за 3 дней(-я)
(1 отзыв)
1.8
jinjinwu

( ͡ᵔ ͜ʖ ͡ᵔ ) Hi, Client. Thank you for your job posting. I read your description very carefully. I have experience in the PHP framework(Laravel and Codeigniter) and Wordpress development for 5 years long. And I majored Больше

£150 GBP за 7 дней(-я)
(3 отзывов(-а))
1.6
finest2019

Hello! Over the last 10 years, I have developed data-driven applications mostly for the web using advanced backend with PHP/MySQL/NodeJS and rich frontend HTML/CSS/JavaScript(angularJS, vueJS, reactJS). My experience i Больше

£135 GBP за 1 день
(2 отзывов(-а))
1.6
Mexi2705

Hello I am having 10+ years of experience in development in same field. https://www.freelancer.in/u/Mexi2705/ you can go with my profile. I am full time freelancer. Let's connect and discuss in details. Thank you

£500 GBP за 7 дней(-я)
(1 отзыв)
0.0
pynki

HI, lets have a chat about the specifications of the task. 1. will not work without clarification - the division might produce something else than an int. About 3. we also should talk before starting this job. Cheer Больше

£80 GBP за 1 день
(0 отзывов(-а))
0.0
shethap

Hi, I have 10 years of rich experience in nava & I am working as a freelancer. I can assist you that I will not charge reasonably good with better quality output.

£20 GBP за 1 день
(0 отзывов(-а))
0.0